This wiki has had no edits or log actions made within the last 45 days and has been automatically marked as inactive. If you would like to prevent this wiki from being closed, please start showing signs of activity here. If there are no signs of this wiki being used within the next 15 days, this wiki will be closed in accordance to the Problem:IOL/2010/i4/en
IOL 2010 Problem #4 mRNA Sequencing
One of the major achievements in genetics was the decipherment of the genetic code—the creation of an mRNA–polypeptide dictionary. Polypeptides (proteins) are building blocks of all living organisms. Polypeptide molecules are chains that consist of amino acids (denoted as Arg, Leu, Phe etc.), and it is the sequence of amino acids in the polypeptide that determines its properties. When cells synthesize polypeptides, they follow instructions written in molecules of messenger ribonucleic acid (mRNA), chains that consist of four nucleotides (denoted as U, C, A, G). If a cell uses as a template the following mRNA sequence:
GAAUGAGGUGGUGUCUUGUGUGCGAGUUAUUCUAAAUGAACCGCUAGAUGGGUCAUGCGCCGGACGUAGGAUU
GUUUCAGGCACCCACUAUUCUGUACGUCCAAAUAGAUAAAGUUGCCUCA,
the following polypeptides will be synthesized:
- Met-Ser-Arg-Ser-His-Thr-Pro-Pro-Ser-Glu-Ser-Ser-Leu-Lys-Asn-Leu-Ala-Arg-Gly-Arg-Ile-Tyr-Thr-Arg
- Met-Arg-Trp-Cys-Leu-Val-Cys-Glu-Leu-Phe
- Met-Asn-Arg
- Met-Gly-His-Ala-Pro-Asp-Val-Gly-Leu-Phe-Gln-Ala-Pro-Thr-Ile-Leu-Tyr-Val-Gln-Ile-Asp-Lys-Val-Ala-Ser
(a) A cell uses the following mRNA sequence:
- AUGUUAACGUUCUAAAUGUGGGGGGGACACCAG
- What polypeptide(s) will it synthesize?
(b) A cell synthesized the following polypeptide:
- Met-Lys-Cys-Ile
- What mRNA sequence(s) could it have used?
(c) The nucleotide pairs are sometimes called roots and classified into two groups: strong roots and weak roots. Examples of strong roots are CU, GU, AC, GG. Examples of weak roots are AU, UA, UG, AA. Classify all the other roots.
⚠ The data presented here are slightly simplified.
—Alexander Berdichevsky